ExiProgen™ Protein Expression Optimization Kit

 Catalog NumberDescriptionPrice(USD) 
♦K-7410ExiProgen™ Protein Expression Optimization Kit$693.00add cart

Specfications

Expression enhanced tags
Tag 1-
Tag 2Expressivity
Tag 3S
Tag 4Ubiquitin
Tag 5Trx
Tag 6 SNUT
Shipping conditiondry ice

Product Overview

ExiProgen™ Protein Expression Optimization Kit is used for generating linear template DNA that contains six different types of tag sequences. The template DNA made from this kit can be used for cell-free protein synthesis.

This product can be used to generate template DNA with sequences that can synthesize various tags for screening and maximizing the target protein expression. This allows expressing proteins with template DNA samples that were once difficult to express using ExiProgen™ protein synthesis system. Furthermore, each of the template DNA contains TEV cleavage sites, allowing removal of tags after the protein synthesis if needed.

Features and Benefits

  • Convenient

    Contains all the components essential for generating maximum of 30 different types of template DNA. (However, you must order the 1st primer set for 1st PCR of target gene separately.)

  • Rapid

    Saves time by skipping the cloning step by getting the template DNA through PCR.

  • Minimized PCR error

    Provides AccuPower® ProFi Taq PCR PreMix, having high accuracy and precision, to lower the error rate as much as possible

Procedure

(A) 1st PCR primer design

1st Forward primer GAGCTCGAAAACTTATATTTTCAGGGC
+ 21 mer from the target gene's 5' end.
1st Reverse primer GGGCTTTGTTAGCAGCCGGTCGACCTA
+ 21 mer from the target gene's 3' gene in reverse complimentary sequence.

E.g.) Control DNA, control primer sets

(B) Template DNA synthesis

Template DNA is synthesized with two PCR steps.

1) 1st PCR: Amplify the gene of the target protein by using the extended primer (may be ordered with our customized service) containing parts of cassettes.

2) 2nd PCR: Produce the template DNA with an overlapping PCR by using the 1st PCR products and the cassette that you wish to use.

Figures

1) Control DNA (18 kDa)

Figure1. Template DNA construction and protein synthesis data for the control DNA.
Each linear template DNA was generated by using ExiProgen™ Protein Expression Optimization Kit.
The linear template DNA was used as templates for protein synthesis with our various protein synthesis kits. Length of the control DNA is 462 bp and molecular weight of the control protein is 18 kDa.

Data (A): 2nd PCR product using the 1% agarose gel image.
Data (B), (C), (D): Each protein was synthesized using 1 µg of DNA and 22.5 µL of the purified protein was loaded on 12% SDS-PAGE gel.
Lane N: No tagged samples
Lane 1-6: tag 1-6 inserted samples.
2) Synthesis of difficult-to-express proteins

Figure2. Protein synthesis data of various sizes of difficult-to-express proteins.
Difficult-to-express proteins were synthesized using the template DNAs generated by the tag screening kit and ExiProgen™ EC Protein Synthesis Kit.

Data (A-F): Synthesized proteins analyzed by SDS-PAGE.
Lane N: No tagged samples
Lane 1-6: tag 1-6 inserted samples.

Frequently asked questions (FAQs)

The size of the target gene should be less than or equal to 1.5 kb.

For the 1st PCR, use gel purification to find the correct PCR product with the same size as the target product.
For the 2nd PCR, use PCR purification to collect the templates for synthesizing the final protein product.

ExiProgen™ EC Protein Synthesis Kit can be used to synthesis the proteins with fully automated steps.
AccuRapid™ Protein Synthesis Kit also can be used to synthesis manually.
To use with protein synthesis kit, the acceptable purity of the template has A260/A280 ratio higher than or equal to 1.7 and normally 1 µg/rxn of templates are used.
However, optimizing the usage of reactants and their codons based on E. coli can increase the amount of expressed proteins.

The template DNA made with this kit contains a TEV protease cleavage site between the gene of interest and the tag sequences. You may use TEV proteases to obtain the protein with tag removed.
The tag removed protein can be simply acquired using ExiProgen™ EC-Tagfree Protein Synthesis Kit that is for synthesizing a protein and removing the tag automatically.

This kit is for producing 30 kinds of template DNA that are five types of the target genes with the tag 1 to 6. You may make 36 kinds of the template DNA from 6 different genes, instead of the positive control.